Review





Similar Products

95
TaKaRa human ace2 293t cells
Human Ace2 293t Cells, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/293t-ace2+cells/Human+ACE2+293T+Cell+Line/pm42128392-43-0-5
Average 95 stars, based on 1 article reviews
human ace2 293t cells - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

95
TaKaRa 293t cells
(a, b) Binding ELISA curves and apparent half-maximal effective concentration (EC₅₀) values of CLR101 and reference antibodies (CR3022, P2B-2F6, and S309) against the SARS-CoV-2 D614G spike protein (a) and wild-type RBD (b) (n = 2 independent experiments, mean ± s.d.). (c) Apparent EC₅₀ values of CLR101, CR3022, P2B-2F6, and S309 against RBDs of six SARS-CoV-2 variants—wild-type (Wuhan-Hu-1), Alpha (B.1.1.7), Beta (B.1.351), Gamma (P.1), Delta (B.1.617.2), and BA.5 (B.1.1.529.5)—determined by ELISA (n = 2 independent experiments, mean ± s.d.). (d) Epitope binning analysis of CLR101 by competitive ELISA. The heatmap displays the mean percent inhibition of CLR101 binding to wild-type RBD in the presence of excess competitor proteins (ACE2, CLR101, CR3022, P2B-2F6, and S309). Self-competition by CLR101 was included as a positive control for binding inhibition. The color scale indicates the degree of inhibition from 0% to 100% (n = 3 independent experiments). (e, f) Evaluation of in vitro neutralizing activity against D614G spike-pseudotyped lentiviral particles using <t>hACE2-293T</t> cells. (e) Dose-response neutralization curve of CLR101, showing neutralizing activity with an apparent EC₅₀ of 11.1 ± 2.6 nM (n = 2 independent experiments, mean ± s.d.). (f) Percent neutralizing activity of CLR101 alongside benchmark antibodies at a fixed antibody concentration of 100 nM (n = 2 independent experiments, mean ± s.d.).
293t Cells, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/293t-ace2+cells/Human+ACE2+293T+Cell+Line/bio_rxiv__64898__2026__05__10__724059-94-9-12
Average 95 stars, based on 1 article reviews
293t cells - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

99
ATCC hek293t cells expressing sars cov 2 receptor human ace2
Construction and characterization of the XEC-S mRNA vaccine. ( A ) The XEC-S mRNA was constructed to encode the ectodomain S (S1 and S2 subunits) protein of the Omicron-XEC <t>subvariant</t> <t>of</t> <t>SARS-CoV-2</t> with the HexaPro sequence, and to contain an N-terminal tissue plasminogen activator (tPA signal peptide), a C-terminal foldon trimeric sequence and a His 6 tag. The synthesized mRNA carrying a 5′-untranslated region (5′-UTR) and a 3′-UTR was capped at the 5′-terminus and tailed with a poly(A) sequence at the 3′-terminus, then encapsulated with lipid nanoparticles (LNPs) to form XEC-S-mRNA LNPs. Measured stability of the LNP-formulated XEC-S-mRNA ( B ) and control LNPs ( C ) by a DynaPro NanoStar II Light Scattering Detector (DLS) instrument. The samples were stored at 4 °C, 25 °C, and 37 °C for 1 to 7 days, then the particle sizes (diameters) were measured by the DLS. Histograms showing particle sizes of the LNP-formulated XEC-S-mRNA ( D ) and control LNPs ( E ). ( F ) Assessment of the expression of the His-tagged protein encoded by XEC-S-mRNA using flow cytometry. <t>HEK293T</t> cells were incubated with XEC-S mRNA-LNPs or the control LNPs, then stained with the anti-His-FITC antibody prior to conducting fluorescence intensity analysis using a flow cytometer. The shaded region indicates control cells incubated with LNPs, and the magenta line refers to target cells incubated with LNP-formulated XEC-S-mRNA. MFI: median fluorescence intensity.
Hek293t Cells Expressing Sars Cov 2 Receptor Human Ace2, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/293t-ace2+cells/293T/pmc13207987-70-0-13
Average 99 stars, based on 1 article reviews
hek293t cells expressing sars cov 2 receptor human ace2 - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

95
TaKaRa human ace2 293t cell line
Construction and characterization of the XEC-S mRNA vaccine. ( A ) The XEC-S mRNA was constructed to encode the ectodomain S (S1 and S2 subunits) protein of the Omicron-XEC <t>subvariant</t> <t>of</t> <t>SARS-CoV-2</t> with the HexaPro sequence, and to contain an N-terminal tissue plasminogen activator (tPA signal peptide), a C-terminal foldon trimeric sequence and a His 6 tag. The synthesized mRNA carrying a 5′-untranslated region (5′-UTR) and a 3′-UTR was capped at the 5′-terminus and tailed with a poly(A) sequence at the 3′-terminus, then encapsulated with lipid nanoparticles (LNPs) to form XEC-S-mRNA LNPs. Measured stability of the LNP-formulated XEC-S-mRNA ( B ) and control LNPs ( C ) by a DynaPro NanoStar II Light Scattering Detector (DLS) instrument. The samples were stored at 4 °C, 25 °C, and 37 °C for 1 to 7 days, then the particle sizes (diameters) were measured by the DLS. Histograms showing particle sizes of the LNP-formulated XEC-S-mRNA ( D ) and control LNPs ( E ). ( F ) Assessment of the expression of the His-tagged protein encoded by XEC-S-mRNA using flow cytometry. <t>HEK293T</t> cells were incubated with XEC-S mRNA-LNPs or the control LNPs, then stained with the anti-His-FITC antibody prior to conducting fluorescence intensity analysis using a flow cytometer. The shaded region indicates control cells incubated with LNPs, and the magenta line refers to target cells incubated with LNP-formulated XEC-S-mRNA. MFI: median fluorescence intensity.
Human Ace2 293t Cell Line, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/293t-ace2+cells/Human+ACE2+293T+Cell+Line/10__1016_slash_j__virol__2026__110894-94-22-27
Average 95 stars, based on 1 article reviews
human ace2 293t cell line - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

95
TaKaRa ace2293t
Construction and characterization of the XEC-S mRNA vaccine. ( A ) The XEC-S mRNA was constructed to encode the ectodomain S (S1 and S2 subunits) protein of the Omicron-XEC <t>subvariant</t> <t>of</t> <t>SARS-CoV-2</t> with the HexaPro sequence, and to contain an N-terminal tissue plasminogen activator (tPA signal peptide), a C-terminal foldon trimeric sequence and a His 6 tag. The synthesized mRNA carrying a 5′-untranslated region (5′-UTR) and a 3′-UTR was capped at the 5′-terminus and tailed with a poly(A) sequence at the 3′-terminus, then encapsulated with lipid nanoparticles (LNPs) to form XEC-S-mRNA LNPs. Measured stability of the LNP-formulated XEC-S-mRNA ( B ) and control LNPs ( C ) by a DynaPro NanoStar II Light Scattering Detector (DLS) instrument. The samples were stored at 4 °C, 25 °C, and 37 °C for 1 to 7 days, then the particle sizes (diameters) were measured by the DLS. Histograms showing particle sizes of the LNP-formulated XEC-S-mRNA ( D ) and control LNPs ( E ). ( F ) Assessment of the expression of the His-tagged protein encoded by XEC-S-mRNA using flow cytometry. <t>HEK293T</t> cells were incubated with XEC-S mRNA-LNPs or the control LNPs, then stained with the anti-His-FITC antibody prior to conducting fluorescence intensity analysis using a flow cytometer. The shaded region indicates control cells incubated with LNPs, and the magenta line refers to target cells incubated with LNP-formulated XEC-S-mRNA. MFI: median fluorescence intensity.
Ace2293t, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/293t-ace2+cells/Human+ACE2+293T+Cell+Line/pm41729072-304-12-13
Average 95 stars, based on 1 article reviews
ace2293t - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

95
TaKaRa ace2 293t
( A ) Identification of COVID-19 GWAS hits adjacent (± 150bp) to genomic locations of SARS-CoV-2 3CLPro cut sites. Log 10 Sarsport score shown on x axis, Log 10 P value of GWAS hits shown on y axis. Highlighted are clusters of high probability SNPs at high-scoring cut sites. ( B ) OAS1 isoforms COVID-19 GWAS SNPs. The p42 (major allele) isoform and p46 (minor alleles) are determine by a single SNP, rs10774671. A high scoring cut-site (Q384) is located 12 aa upstream of the C-terminus of the p46 OAS1 isoform, which encodes a prenylation site. ( C ) AlphaFold structure of full-length p46 OAS1 with predicted cut-site highlighted. ( D ) Western blot of <t>293T</t> cells overexpressing p46 OAS1 and C145A (catalytically inactive) or active 3CLPro. Full-length (46 kDa) and cleaved product (44 kDa) highlighted. Strep-Tag and HSP90 controls were run on a separate gel from OAS1 staining. ( E ) Immunocytochemistry of 293T cells overexpressing p46 OAS1 and C145A or 3CLPro. Costaining with WGA shown to mark subcellular membrane structures. Scale bar: 10 μm. ( F ) Colocalization quantification of WGA and OAS1 from E . In total, 60–80 individual OAS1 + /3CLPro + or OAS1 + /C145A + cells were traced and colocalization quantified by Pearson’s R value of linear using the Coloc2 ImageJ plugin (NIH). Comparison statistics of R values quantified by 2-tailed Student’s t test. ( G ) Immunocytochemistry <t>of</t> <t>ACE2-293T</t> cells expressing V5 tagged p46 OAS. Costaining of V5 to mark OAS1 with WGA shown to mark subcellular membrane structures. Scale bar: 5 μm. ( H ) Colocalization quantification of WGA and OAS1 from control or COVID infected cells in G . Ten to 18 individual cells were traced and colocalization of WGA and OAS1 quantified by Pearson’s R value of linear using the Coloc2 ImageJ plugin. Comparison statistics of R values quantified by 2-tailed Student’s t test.
Ace2 293t, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/293t-ace2+cells/Human+ACE2+293T+Cell+Line/pmc12956004-214-12-13
Average 95 stars, based on 1 article reviews
ace2 293t - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

95
TaKaRa human cell lines
( A ) Identification of COVID-19 GWAS hits adjacent (± 150bp) to genomic locations of SARS-CoV-2 3CLPro cut sites. Log 10 Sarsport score shown on x axis, Log 10 P value of GWAS hits shown on y axis. Highlighted are clusters of high probability SNPs at high-scoring cut sites. ( B ) OAS1 isoforms COVID-19 GWAS SNPs. The p42 (major allele) isoform and p46 (minor alleles) are determine by a single SNP, rs10774671. A high scoring cut-site (Q384) is located 12 aa upstream of the C-terminus of the p46 OAS1 isoform, which encodes a prenylation site. ( C ) AlphaFold structure of full-length p46 OAS1 with predicted cut-site highlighted. ( D ) Western blot of <t>293T</t> cells overexpressing p46 OAS1 and C145A (catalytically inactive) or active 3CLPro. Full-length (46 kDa) and cleaved product (44 kDa) highlighted. Strep-Tag and HSP90 controls were run on a separate gel from OAS1 staining. ( E ) Immunocytochemistry of 293T cells overexpressing p46 OAS1 and C145A or 3CLPro. Costaining with WGA shown to mark subcellular membrane structures. Scale bar: 10 μm. ( F ) Colocalization quantification of WGA and OAS1 from E . In total, 60–80 individual OAS1 + /3CLPro + or OAS1 + /C145A + cells were traced and colocalization quantified by Pearson’s R value of linear using the Coloc2 ImageJ plugin (NIH). Comparison statistics of R values quantified by 2-tailed Student’s t test. ( G ) Immunocytochemistry <t>of</t> <t>ACE2-293T</t> cells expressing V5 tagged p46 OAS. Costaining of V5 to mark OAS1 with WGA shown to mark subcellular membrane structures. Scale bar: 5 μm. ( H ) Colocalization quantification of WGA and OAS1 from control or COVID infected cells in G . Ten to 18 individual cells were traced and colocalization of WGA and OAS1 quantified by Pearson’s R value of linear using the Coloc2 ImageJ plugin. Comparison statistics of R values quantified by 2-tailed Student’s t test.
Human Cell Lines, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/293t-ace2+cells/Human+ACE2+293T+Cell+Line/pm41348871-264-0-21
Average 95 stars, based on 1 article reviews
human cell lines - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

95
TaKaRa human hu1545 cell line
A Representative BODIPY stained images from <t>Hu1545</t> human hepatocyte cell line treated with palmitate (PA) with or without benitrobenrazide (BNBZ). The experiment was replicated 3 times. Vehicle control (Veh) included equivalent amounts of isopropanol and DMSO. Scale bar: 20 µm. B Quantification of BODIPY staining was performed in Image J. Each dot represents a separate experiment averaged over five fields. Approximately 16–36 cells were counted per field. Data were calculated as the mean intensity divided by the number of cells per field. ** P < 0.01, *** P < 0.001, **** P < 0.0001.
Human Hu1545 Cell Line, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/293t-ace2+cells/Human+ACE2+293T+Cell+Line/pmc12675283-356-7-15
Average 95 stars, based on 1 article reviews
human hu1545 cell line - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

96
Genecopoeia hek 293t cells
A Representative BODIPY stained images from <t>Hu1545</t> human hepatocyte cell line treated with palmitate (PA) with or without benitrobenrazide (BNBZ). The experiment was replicated 3 times. Vehicle control (Veh) included equivalent amounts of isopropanol and DMSO. Scale bar: 20 µm. B Quantification of BODIPY staining was performed in Image J. Each dot represents a separate experiment averaged over five fields. Approximately 16–36 cells were counted per field. Data were calculated as the mean intensity divided by the number of cells per field. ** P < 0.01, *** P < 0.001, **** P < 0.0001.
Hek 293t Cells, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/293t-ace2+cells/HEK293T+cells+stably+expressing+human+ACE2/pm41196038-170-1-11
Average 96 stars, based on 1 article reviews
hek 293t cells - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

Image Search Results


(a, b) Binding ELISA curves and apparent half-maximal effective concentration (EC₅₀) values of CLR101 and reference antibodies (CR3022, P2B-2F6, and S309) against the SARS-CoV-2 D614G spike protein (a) and wild-type RBD (b) (n = 2 independent experiments, mean ± s.d.). (c) Apparent EC₅₀ values of CLR101, CR3022, P2B-2F6, and S309 against RBDs of six SARS-CoV-2 variants—wild-type (Wuhan-Hu-1), Alpha (B.1.1.7), Beta (B.1.351), Gamma (P.1), Delta (B.1.617.2), and BA.5 (B.1.1.529.5)—determined by ELISA (n = 2 independent experiments, mean ± s.d.). (d) Epitope binning analysis of CLR101 by competitive ELISA. The heatmap displays the mean percent inhibition of CLR101 binding to wild-type RBD in the presence of excess competitor proteins (ACE2, CLR101, CR3022, P2B-2F6, and S309). Self-competition by CLR101 was included as a positive control for binding inhibition. The color scale indicates the degree of inhibition from 0% to 100% (n = 3 independent experiments). (e, f) Evaluation of in vitro neutralizing activity against D614G spike-pseudotyped lentiviral particles using hACE2-293T cells. (e) Dose-response neutralization curve of CLR101, showing neutralizing activity with an apparent EC₅₀ of 11.1 ± 2.6 nM (n = 2 independent experiments, mean ± s.d.). (f) Percent neutralizing activity of CLR101 alongside benchmark antibodies at a fixed antibody concentration of 100 nM (n = 2 independent experiments, mean ± s.d.).

Journal: bioRxiv

Article Title: Staged heavy-chain filtering enables Fab discovery from combinatorially intractable library spaces

doi: 10.64898/2026.05.10.724059

Figure Lengend Snippet: (a, b) Binding ELISA curves and apparent half-maximal effective concentration (EC₅₀) values of CLR101 and reference antibodies (CR3022, P2B-2F6, and S309) against the SARS-CoV-2 D614G spike protein (a) and wild-type RBD (b) (n = 2 independent experiments, mean ± s.d.). (c) Apparent EC₅₀ values of CLR101, CR3022, P2B-2F6, and S309 against RBDs of six SARS-CoV-2 variants—wild-type (Wuhan-Hu-1), Alpha (B.1.1.7), Beta (B.1.351), Gamma (P.1), Delta (B.1.617.2), and BA.5 (B.1.1.529.5)—determined by ELISA (n = 2 independent experiments, mean ± s.d.). (d) Epitope binning analysis of CLR101 by competitive ELISA. The heatmap displays the mean percent inhibition of CLR101 binding to wild-type RBD in the presence of excess competitor proteins (ACE2, CLR101, CR3022, P2B-2F6, and S309). Self-competition by CLR101 was included as a positive control for binding inhibition. The color scale indicates the degree of inhibition from 0% to 100% (n = 3 independent experiments). (e, f) Evaluation of in vitro neutralizing activity against D614G spike-pseudotyped lentiviral particles using hACE2-293T cells. (e) Dose-response neutralization curve of CLR101, showing neutralizing activity with an apparent EC₅₀ of 11.1 ± 2.6 nM (n = 2 independent experiments, mean ± s.d.). (f) Percent neutralizing activity of CLR101 alongside benchmark antibodies at a fixed antibody concentration of 100 nM (n = 2 independent experiments, mean ± s.d.).

Article Snippet: Virus–antibody mixtures were then added to monolayers of hACE2-expressing 293T cells (hACE2-293T; Takara Bio Inc., Kusatsu, Shiga, Japan) in 96-well plates.

Techniques: Binding Assay, Enzyme-linked Immunosorbent Assay, Concentration Assay, Competitive ELISA, Inhibition, Positive Control, In Vitro, Activity Assay, Neutralization

Construction and characterization of the XEC-S mRNA vaccine. ( A ) The XEC-S mRNA was constructed to encode the ectodomain S (S1 and S2 subunits) protein of the Omicron-XEC subvariant of SARS-CoV-2 with the HexaPro sequence, and to contain an N-terminal tissue plasminogen activator (tPA signal peptide), a C-terminal foldon trimeric sequence and a His 6 tag. The synthesized mRNA carrying a 5′-untranslated region (5′-UTR) and a 3′-UTR was capped at the 5′-terminus and tailed with a poly(A) sequence at the 3′-terminus, then encapsulated with lipid nanoparticles (LNPs) to form XEC-S-mRNA LNPs. Measured stability of the LNP-formulated XEC-S-mRNA ( B ) and control LNPs ( C ) by a DynaPro NanoStar II Light Scattering Detector (DLS) instrument. The samples were stored at 4 °C, 25 °C, and 37 °C for 1 to 7 days, then the particle sizes (diameters) were measured by the DLS. Histograms showing particle sizes of the LNP-formulated XEC-S-mRNA ( D ) and control LNPs ( E ). ( F ) Assessment of the expression of the His-tagged protein encoded by XEC-S-mRNA using flow cytometry. HEK293T cells were incubated with XEC-S mRNA-LNPs or the control LNPs, then stained with the anti-His-FITC antibody prior to conducting fluorescence intensity analysis using a flow cytometer. The shaded region indicates control cells incubated with LNPs, and the magenta line refers to target cells incubated with LNP-formulated XEC-S-mRNA. MFI: median fluorescence intensity.

Journal: International Journal of Molecular Sciences

Article Title: Immunogenicity and Protection of mRNA Vaccine Encoding Spike Protein of SARS-CoV-2 Omicron-XEC Subvariant

doi: 10.3390/ijms27104218

Figure Lengend Snippet: Construction and characterization of the XEC-S mRNA vaccine. ( A ) The XEC-S mRNA was constructed to encode the ectodomain S (S1 and S2 subunits) protein of the Omicron-XEC subvariant of SARS-CoV-2 with the HexaPro sequence, and to contain an N-terminal tissue plasminogen activator (tPA signal peptide), a C-terminal foldon trimeric sequence and a His 6 tag. The synthesized mRNA carrying a 5′-untranslated region (5′-UTR) and a 3′-UTR was capped at the 5′-terminus and tailed with a poly(A) sequence at the 3′-terminus, then encapsulated with lipid nanoparticles (LNPs) to form XEC-S-mRNA LNPs. Measured stability of the LNP-formulated XEC-S-mRNA ( B ) and control LNPs ( C ) by a DynaPro NanoStar II Light Scattering Detector (DLS) instrument. The samples were stored at 4 °C, 25 °C, and 37 °C for 1 to 7 days, then the particle sizes (diameters) were measured by the DLS. Histograms showing particle sizes of the LNP-formulated XEC-S-mRNA ( D ) and control LNPs ( E ). ( F ) Assessment of the expression of the His-tagged protein encoded by XEC-S-mRNA using flow cytometry. HEK293T cells were incubated with XEC-S mRNA-LNPs or the control LNPs, then stained with the anti-His-FITC antibody prior to conducting fluorescence intensity analysis using a flow cytometer. The shaded region indicates control cells incubated with LNPs, and the magenta line refers to target cells incubated with LNP-formulated XEC-S-mRNA. MFI: median fluorescence intensity.

Article Snippet: HEK293T cells expressing SARS-CoV-2 receptor human ACE2 (hACE2/293T, Laboratory stock) and HEK293T cells (ATCC, Manassas, VA, USA) were diluted in Dulbecco’s Modified Eagle Medium (DMEM) cell culture medium containing 1% Penicillin-Streptomycin solution (Corning, New York, NY, USA) and 10% Fetal Bovine Serum (FBS) (R&D Systems, Minneapolis, MN, USA), and cultured in a 37 °C cell culture incubator supplied with 5% CO 2 .

Techniques: Construct, Sequencing, Synthesized, Control, Expressing, Flow Cytometry, Incubation, Staining, Fluorescence

Assessment of humoral immune responses induced by the XEC-S-mRNA vaccine. ( A ) Immunization and challenge schedules. BALB/c-hACE2 transgenic mice were intradermally (i.d.) immunized with LNP-formulated XEC-S-mRNA or control LNPs and boosted twice at 3-week intervals; collection of sera followed 10 days after the last dose for measurement of subsequent antibody responses. Nine weeks after the last dose, the immunized mice were then intranasally (i.n.) challenged with an Omicron-KP.3 subvariant of SARS-CoV-2 to assess the protective efficacy. Evaluation of the XEC-S-specific IgG ( B ), IgG1 ( C ), and IgG2a ( D ) antibody (Ab) titers in sera by ELISA. The data refers to the mean ± standard deviation of the mean (s.e.m) of five mice in each group. The dotted lines indicate the detection limit (1:30). The experiments were repeated once, with similar results obtained.

Journal: International Journal of Molecular Sciences

Article Title: Immunogenicity and Protection of mRNA Vaccine Encoding Spike Protein of SARS-CoV-2 Omicron-XEC Subvariant

doi: 10.3390/ijms27104218

Figure Lengend Snippet: Assessment of humoral immune responses induced by the XEC-S-mRNA vaccine. ( A ) Immunization and challenge schedules. BALB/c-hACE2 transgenic mice were intradermally (i.d.) immunized with LNP-formulated XEC-S-mRNA or control LNPs and boosted twice at 3-week intervals; collection of sera followed 10 days after the last dose for measurement of subsequent antibody responses. Nine weeks after the last dose, the immunized mice were then intranasally (i.n.) challenged with an Omicron-KP.3 subvariant of SARS-CoV-2 to assess the protective efficacy. Evaluation of the XEC-S-specific IgG ( B ), IgG1 ( C ), and IgG2a ( D ) antibody (Ab) titers in sera by ELISA. The data refers to the mean ± standard deviation of the mean (s.e.m) of five mice in each group. The dotted lines indicate the detection limit (1:30). The experiments were repeated once, with similar results obtained.

Article Snippet: HEK293T cells expressing SARS-CoV-2 receptor human ACE2 (hACE2/293T, Laboratory stock) and HEK293T cells (ATCC, Manassas, VA, USA) were diluted in Dulbecco’s Modified Eagle Medium (DMEM) cell culture medium containing 1% Penicillin-Streptomycin solution (Corning, New York, NY, USA) and 10% Fetal Bovine Serum (FBS) (R&D Systems, Minneapolis, MN, USA), and cultured in a 37 °C cell culture incubator supplied with 5% CO 2 .

Techniques: Transgenic Assay, Control, Enzyme-linked Immunosorbent Assay, Standard Deviation

Evaluation of the broad neutralizing antibody responses induced by the XEC-S-mRNA vaccine. Mouse sera collected 10 days after the third immunization were assessed for a neutralizing antibody (Ab) titer against pseudotyped Omicron-KP.2 ( A ), KP.3 ( B ), XEC ( C ), NB.1.8.1 ( D ), and XFG ( E ) using a pseudovirus neutralization assay. The same sera were assessed for a neutralizing Ab titer against the infection of live SARS-CoV-2 Omicron subvariants, including KP.2 ( F ) and KP.3 ( G ), using a cytopathic effect (CPE)-based neutralization assay. The NT 50 (i.e., 50% neutralizing Ab titer) is shown as the mean ± s.e.m of five mice in each group. The dotted lines indicate the detection limit (1:60 for the pseudovirus neutralizing Ab titer, and 1:30 for the live virus neutralizing Ab titer). The experiments were repeated once, with similar results obtained.

Journal: International Journal of Molecular Sciences

Article Title: Immunogenicity and Protection of mRNA Vaccine Encoding Spike Protein of SARS-CoV-2 Omicron-XEC Subvariant

doi: 10.3390/ijms27104218

Figure Lengend Snippet: Evaluation of the broad neutralizing antibody responses induced by the XEC-S-mRNA vaccine. Mouse sera collected 10 days after the third immunization were assessed for a neutralizing antibody (Ab) titer against pseudotyped Omicron-KP.2 ( A ), KP.3 ( B ), XEC ( C ), NB.1.8.1 ( D ), and XFG ( E ) using a pseudovirus neutralization assay. The same sera were assessed for a neutralizing Ab titer against the infection of live SARS-CoV-2 Omicron subvariants, including KP.2 ( F ) and KP.3 ( G ), using a cytopathic effect (CPE)-based neutralization assay. The NT 50 (i.e., 50% neutralizing Ab titer) is shown as the mean ± s.e.m of five mice in each group. The dotted lines indicate the detection limit (1:60 for the pseudovirus neutralizing Ab titer, and 1:30 for the live virus neutralizing Ab titer). The experiments were repeated once, with similar results obtained.

Article Snippet: HEK293T cells expressing SARS-CoV-2 receptor human ACE2 (hACE2/293T, Laboratory stock) and HEK293T cells (ATCC, Manassas, VA, USA) were diluted in Dulbecco’s Modified Eagle Medium (DMEM) cell culture medium containing 1% Penicillin-Streptomycin solution (Corning, New York, NY, USA) and 10% Fetal Bovine Serum (FBS) (R&D Systems, Minneapolis, MN, USA), and cultured in a 37 °C cell culture incubator supplied with 5% CO 2 .

Techniques: Neutralization, Infection, Virus

The LNP-formulated XEC-S-mRNA vaccine protected against a SARS-CoV-2 Omicron-KP.3 challenge. Nine weeks after the final immunization, the BALB/c-hACE2 transgenic mice were challenged (i.n.) with an Omicron-KP.3 subvariant of SARS-CoV-2, then viral titers in the lungs ( A ) and trachea ( B ) were measured by means of the plaque assay 5 days post-challenge. The data (plaque-forming unit: PFU/mL of viral titers) is shown as the mean ± s.e.m of five mice in each group. The dotted lines indicate the detection limit (3.3 PFU/mL). The unpaired Student’s t test was used to analyze statistical significance between the XEC-S-mRNA and control LNP groups. ** indicates p < 0.01. The experiments were repeated once, with similar results obtained.

Journal: International Journal of Molecular Sciences

Article Title: Immunogenicity and Protection of mRNA Vaccine Encoding Spike Protein of SARS-CoV-2 Omicron-XEC Subvariant

doi: 10.3390/ijms27104218

Figure Lengend Snippet: The LNP-formulated XEC-S-mRNA vaccine protected against a SARS-CoV-2 Omicron-KP.3 challenge. Nine weeks after the final immunization, the BALB/c-hACE2 transgenic mice were challenged (i.n.) with an Omicron-KP.3 subvariant of SARS-CoV-2, then viral titers in the lungs ( A ) and trachea ( B ) were measured by means of the plaque assay 5 days post-challenge. The data (plaque-forming unit: PFU/mL of viral titers) is shown as the mean ± s.e.m of five mice in each group. The dotted lines indicate the detection limit (3.3 PFU/mL). The unpaired Student’s t test was used to analyze statistical significance between the XEC-S-mRNA and control LNP groups. ** indicates p < 0.01. The experiments were repeated once, with similar results obtained.

Article Snippet: HEK293T cells expressing SARS-CoV-2 receptor human ACE2 (hACE2/293T, Laboratory stock) and HEK293T cells (ATCC, Manassas, VA, USA) were diluted in Dulbecco’s Modified Eagle Medium (DMEM) cell culture medium containing 1% Penicillin-Streptomycin solution (Corning, New York, NY, USA) and 10% Fetal Bovine Serum (FBS) (R&D Systems, Minneapolis, MN, USA), and cultured in a 37 °C cell culture incubator supplied with 5% CO 2 .

Techniques: Transgenic Assay, Plaque Assay, Control

XEC-S-mRNA-induced neutralizing antibodies play a key role in the protection against a SARS-CoV-2 Omicron-KP.3 challenge. ( A ) Immunization and serum transfer schedules. BALB/c mice were immunized (i.d.) with LNP-formulated XEC-S-mRNA or control LNPs and boosted at 3, 6, and 22 weeks. The pooled sera collected at 10, 17, and 28 days after the last dose were assessed for neutralizing antibody (Ab) titers against pseudotyped ( B ) and live ( C ) Omicron-KP.3 subvariants of SARS-CoV-2, then injected (i.p.) into naïve B6-hACE2 transgenic mice. 6 h post serum-transfer, the mice were challenged (i.n.) with Omicron-KP.3; five days post-challenge, the lungs ( D ) and trachea ( E ) were collected and assessed for viral titers using the plaque assay. The NT 50 indicates a 50% neutralizing Ab titer, and the viral titer is expressed as PFU/mL. The data is shown as the mean ± s.e.m of duplicate or quadruple wells (for the pooled sera) or of five mice in each group (for the viral titer). The dotted lines indicate the detection limit (1:60 for the pseudovirus neutralizing Ab titer, 1:30 for the live virus neutralizing Ab titer, and 3.3 PFU/mL for the viral titer). The unpaired Student’s t test was used to analyze the statistical significance between the XEC-S-mRNA and control LNP groups. * and **** indicate p < 0.05 and p < 0.0001, respectively. The experiments were repeated once, with similar results obtained.

Journal: International Journal of Molecular Sciences

Article Title: Immunogenicity and Protection of mRNA Vaccine Encoding Spike Protein of SARS-CoV-2 Omicron-XEC Subvariant

doi: 10.3390/ijms27104218

Figure Lengend Snippet: XEC-S-mRNA-induced neutralizing antibodies play a key role in the protection against a SARS-CoV-2 Omicron-KP.3 challenge. ( A ) Immunization and serum transfer schedules. BALB/c mice were immunized (i.d.) with LNP-formulated XEC-S-mRNA or control LNPs and boosted at 3, 6, and 22 weeks. The pooled sera collected at 10, 17, and 28 days after the last dose were assessed for neutralizing antibody (Ab) titers against pseudotyped ( B ) and live ( C ) Omicron-KP.3 subvariants of SARS-CoV-2, then injected (i.p.) into naïve B6-hACE2 transgenic mice. 6 h post serum-transfer, the mice were challenged (i.n.) with Omicron-KP.3; five days post-challenge, the lungs ( D ) and trachea ( E ) were collected and assessed for viral titers using the plaque assay. The NT 50 indicates a 50% neutralizing Ab titer, and the viral titer is expressed as PFU/mL. The data is shown as the mean ± s.e.m of duplicate or quadruple wells (for the pooled sera) or of five mice in each group (for the viral titer). The dotted lines indicate the detection limit (1:60 for the pseudovirus neutralizing Ab titer, 1:30 for the live virus neutralizing Ab titer, and 3.3 PFU/mL for the viral titer). The unpaired Student’s t test was used to analyze the statistical significance between the XEC-S-mRNA and control LNP groups. * and **** indicate p < 0.05 and p < 0.0001, respectively. The experiments were repeated once, with similar results obtained.

Article Snippet: HEK293T cells expressing SARS-CoV-2 receptor human ACE2 (hACE2/293T, Laboratory stock) and HEK293T cells (ATCC, Manassas, VA, USA) were diluted in Dulbecco’s Modified Eagle Medium (DMEM) cell culture medium containing 1% Penicillin-Streptomycin solution (Corning, New York, NY, USA) and 10% Fetal Bovine Serum (FBS) (R&D Systems, Minneapolis, MN, USA), and cultured in a 37 °C cell culture incubator supplied with 5% CO 2 .

Techniques: Control, Injection, Transgenic Assay, Plaque Assay, Virus

( A ) Identification of COVID-19 GWAS hits adjacent (± 150bp) to genomic locations of SARS-CoV-2 3CLPro cut sites. Log 10 Sarsport score shown on x axis, Log 10 P value of GWAS hits shown on y axis. Highlighted are clusters of high probability SNPs at high-scoring cut sites. ( B ) OAS1 isoforms COVID-19 GWAS SNPs. The p42 (major allele) isoform and p46 (minor alleles) are determine by a single SNP, rs10774671. A high scoring cut-site (Q384) is located 12 aa upstream of the C-terminus of the p46 OAS1 isoform, which encodes a prenylation site. ( C ) AlphaFold structure of full-length p46 OAS1 with predicted cut-site highlighted. ( D ) Western blot of 293T cells overexpressing p46 OAS1 and C145A (catalytically inactive) or active 3CLPro. Full-length (46 kDa) and cleaved product (44 kDa) highlighted. Strep-Tag and HSP90 controls were run on a separate gel from OAS1 staining. ( E ) Immunocytochemistry of 293T cells overexpressing p46 OAS1 and C145A or 3CLPro. Costaining with WGA shown to mark subcellular membrane structures. Scale bar: 10 μm. ( F ) Colocalization quantification of WGA and OAS1 from E . In total, 60–80 individual OAS1 + /3CLPro + or OAS1 + /C145A + cells were traced and colocalization quantified by Pearson’s R value of linear using the Coloc2 ImageJ plugin (NIH). Comparison statistics of R values quantified by 2-tailed Student’s t test. ( G ) Immunocytochemistry of ACE2-293T cells expressing V5 tagged p46 OAS. Costaining of V5 to mark OAS1 with WGA shown to mark subcellular membrane structures. Scale bar: 5 μm. ( H ) Colocalization quantification of WGA and OAS1 from control or COVID infected cells in G . Ten to 18 individual cells were traced and colocalization of WGA and OAS1 quantified by Pearson’s R value of linear using the Coloc2 ImageJ plugin. Comparison statistics of R values quantified by 2-tailed Student’s t test.

Journal: JCI Insight

Article Title: Unbiased cleavage site prediction uncovers viral antagonism of host innate immunity by SARS-CoV-2 3C-like protease

doi: 10.1172/jci.insight.185739

Figure Lengend Snippet: ( A ) Identification of COVID-19 GWAS hits adjacent (± 150bp) to genomic locations of SARS-CoV-2 3CLPro cut sites. Log 10 Sarsport score shown on x axis, Log 10 P value of GWAS hits shown on y axis. Highlighted are clusters of high probability SNPs at high-scoring cut sites. ( B ) OAS1 isoforms COVID-19 GWAS SNPs. The p42 (major allele) isoform and p46 (minor alleles) are determine by a single SNP, rs10774671. A high scoring cut-site (Q384) is located 12 aa upstream of the C-terminus of the p46 OAS1 isoform, which encodes a prenylation site. ( C ) AlphaFold structure of full-length p46 OAS1 with predicted cut-site highlighted. ( D ) Western blot of 293T cells overexpressing p46 OAS1 and C145A (catalytically inactive) or active 3CLPro. Full-length (46 kDa) and cleaved product (44 kDa) highlighted. Strep-Tag and HSP90 controls were run on a separate gel from OAS1 staining. ( E ) Immunocytochemistry of 293T cells overexpressing p46 OAS1 and C145A or 3CLPro. Costaining with WGA shown to mark subcellular membrane structures. Scale bar: 10 μm. ( F ) Colocalization quantification of WGA and OAS1 from E . In total, 60–80 individual OAS1 + /3CLPro + or OAS1 + /C145A + cells were traced and colocalization quantified by Pearson’s R value of linear using the Coloc2 ImageJ plugin (NIH). Comparison statistics of R values quantified by 2-tailed Student’s t test. ( G ) Immunocytochemistry of ACE2-293T cells expressing V5 tagged p46 OAS. Costaining of V5 to mark OAS1 with WGA shown to mark subcellular membrane structures. Scale bar: 5 μm. ( H ) Colocalization quantification of WGA and OAS1 from control or COVID infected cells in G . Ten to 18 individual cells were traced and colocalization of WGA and OAS1 quantified by Pearson’s R value of linear using the Coloc2 ImageJ plugin. Comparison statistics of R values quantified by 2-tailed Student’s t test.

Article Snippet: For 293T overexpression assays, commercially available 293T (ATCC, catalog CRL 3216) or ACE2-293T (Takara, catalog 631289) were cultured according to manufacturer’s protocol.

Techniques: Western Blot, Strep-tag, Staining, Immunocytochemistry, Membrane, Comparison, Expressing, Control, Infection

A Representative BODIPY stained images from Hu1545 human hepatocyte cell line treated with palmitate (PA) with or without benitrobenrazide (BNBZ). The experiment was replicated 3 times. Vehicle control (Veh) included equivalent amounts of isopropanol and DMSO. Scale bar: 20 µm. B Quantification of BODIPY staining was performed in Image J. Each dot represents a separate experiment averaged over five fields. Approximately 16–36 cells were counted per field. Data were calculated as the mean intensity divided by the number of cells per field. ** P < 0.01, *** P < 0.001, **** P < 0.0001.

Journal: Npj Gut and Liver

Article Title: Silencing of S100A11 attenuates murine metabolic dysfunction-associated steatohepatitis

doi: 10.1038/s44355-025-00044-w

Figure Lengend Snippet: A Representative BODIPY stained images from Hu1545 human hepatocyte cell line treated with palmitate (PA) with or without benitrobenrazide (BNBZ). The experiment was replicated 3 times. Vehicle control (Veh) included equivalent amounts of isopropanol and DMSO. Scale bar: 20 µm. B Quantification of BODIPY staining was performed in Image J. Each dot represents a separate experiment averaged over five fields. Approximately 16–36 cells were counted per field. Data were calculated as the mean intensity divided by the number of cells per field. ** P < 0.01, *** P < 0.001, **** P < 0.0001.

Article Snippet: S100A11 knockout cells were generated in the human Hu1545 cell line using Guide-it® CRISPR/Cas9 System (Takara Bio) with these single guide sequences 5’—AATTAGACAGAGTTCCTAAGCTTC and 3’—AATTGAAGCTTAGGAACTCTGTCT.

Techniques: Staining, Control